Transcript: Human NM_004386.3

Homo sapiens neurocan (NCAN), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NCAN (1463)
Length:
6402
CDS:
115..4080

Additional Resources:

NCBI RefSeq record:
NM_004386.3
NBCI Gene record:
NCAN (1463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436959 ACAACACCGGGCTGCAATTTG pLKO_005 3593 CDS 100% 13.200 18.480 N NCAN n/a
2 TRCN0000414769 ATTGGTCTGGTCTCTTGTTTG pLKO_005 4361 3UTR 100% 10.800 15.120 N NCAN n/a
3 TRCN0000056162 TGCAACTACAACCTACCCTAT pLKO.1 3712 CDS 100% 4.050 5.670 N NCAN n/a
4 TRCN0000056161 CCAGTGATGCTAGTGGAATTT pLKO.1 2624 CDS 100% 13.200 9.240 N NCAN n/a
5 TRCN0000445255 GAGAACCAGCCGGACAATTTC pLKO_005 3625 CDS 100% 13.200 9.240 N NCAN n/a
6 TRCN0000416835 GAAATTCAGACTTAGTCAATG pLKO_005 4462 3UTR 100% 10.800 7.560 N NCAN n/a
7 TRCN0000056159 CTTGTCTTCATGGAGGGACAT pLKO.1 3161 CDS 100% 4.050 2.835 N NCAN n/a
8 TRCN0000056158 GCCAATAGAGTTGAGGCACAT pLKO.1 2074 CDS 100% 4.050 2.835 N NCAN n/a
9 TRCN0000056160 GCTGCCTTTGAGGATGGCTTT pLKO.1 703 CDS 100% 4.050 2.835 N NCAN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.