Transcript: Human NM_004416.2

Homo sapiens deltex E3 ubiquitin ligase 1 (DTX1), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
DTX1 (1840)
Length:
3317
CDS:
337..2199

Additional Resources:

NCBI RefSeq record:
NM_004416.2
NBCI Gene record:
DTX1 (1840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413108 AGACCATCCGCATCGTCTATG pLKO_005 1844 CDS 100% 10.800 15.120 N DTX1 n/a
2 TRCN0000005025 CAACAGCATGTCGCAGATGAA pLKO.1 795 CDS 100% 4.950 6.930 N DTX1 n/a
3 TRCN0000005024 CGGTGAAGAACTTGAATGGTA pLKO.1 1292 CDS 100% 3.000 2.400 N DTX1 n/a
4 TRCN0000005026 GACCAAGAAGAAGCACCTTAA pLKO.1 1476 CDS 100% 10.800 7.560 N DTX1 n/a
5 TRCN0000413982 GAGGATGTGGTTCGAAGATAC pLKO_005 1513 CDS 100% 10.800 7.560 N DTX1 n/a
6 TRCN0000005023 CCACTGCTATCTACCCAACAA pLKO.1 1938 CDS 100% 4.950 3.465 N DTX1 n/a
7 TRCN0000423632 GACGCTAGCTACCTAGACAAC pLKO_005 2125 CDS 100% 4.050 2.835 N DTX1 n/a
8 TRCN0000005022 GCAGAGAGTCAATTTCCCTTT pLKO.1 3068 3UTR 100% 4.050 2.835 N DTX1 n/a
9 TRCN0000420395 TGTACTCCAATGGCAACAAGG pLKO_005 1703 CDS 100% 4.050 2.835 N DTX1 n/a
10 TRCN0000037392 TGCCGCAAGACCAAGAAGAAA pLKO.1 1468 CDS 100% 5.625 3.938 N Dtx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.