Transcript: Human NM_004418.4

Homo sapiens dual specificity phosphatase 2 (DUSP2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DUSP2 (1844)
Length:
1685
CDS:
87..1031

Additional Resources:

NCBI RefSeq record:
NM_004418.4
NBCI Gene record:
DUSP2 (1844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235435 CGAGGCCTTTGACTTCGTTAA pLKO_005 929 CDS 100% 10.800 15.120 N DUSP2 n/a
2 TRCN0000235437 GAAATCAGCTAGACGCTATAC pLKO_005 1300 3UTR 100% 10.800 15.120 N DUSP2 n/a
3 TRCN0000355668 CCGCTACAAGAGTATCCCTGT pLKO_005 737 CDS 100% 2.160 1.728 N DUSP2 n/a
4 TRCN0000235436 AGGAGGCCATAGGCTTCATTG pLKO_005 796 CDS 100% 10.800 7.560 N DUSP2 n/a
5 TRCN0000355665 CAAGGGTGTGTCTGCTCTTTC pLKO_005 1261 3UTR 100% 10.800 7.560 N DUSP2 n/a
6 TRCN0000235434 ACAACCAGATGGTGGAGATCA pLKO_005 763 CDS 100% 4.950 3.465 N DUSP2 n/a
7 TRCN0000051904 CATCTGTCTGGCATACCTCAT pLKO.1 884 CDS 100% 4.050 2.835 N DUSP2 n/a
8 TRCN0000244310 CCAACCACTTTGAGGGCCTTT pLKO_005 715 CDS 100% 4.050 2.835 N DUSP2 n/a
9 TRCN0000355667 GGAGATCTTGCCCTACCTGTT pLKO_005 608 CDS 100% 4.050 2.835 N DUSP2 n/a
10 TRCN0000355666 TGGCATACCTCATGCAGAGTC pLKO_005 892 CDS 100% 4.050 2.835 N DUSP2 n/a
11 TRCN0000051903 TGTGTCTGTCTGTGAGCCTTT pLKO.1 1500 3UTR 100% 4.050 2.835 N DUSP2 n/a
12 TRCN0000051907 TGTCCCGATCTGTGCTCTGAG pLKO.1 501 CDS 100% 1.350 0.945 N DUSP2 n/a
13 TRCN0000051906 TGCTGTCCCGATCTGTGCTCT pLKO.1 498 CDS 100% 0.880 0.616 N DUSP2 n/a
14 TRCN0000051905 ACTGCCGTGTACTTCCTGCGA pLKO.1 453 CDS 100% 0.220 0.154 N DUSP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.