Transcript: Human NM_004519.4

Homo sapiens potassium voltage-gated channel subfamily Q member 3 (KCNQ3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KCNQ3 (3786)
Length:
11583
CDS:
564..3182

Additional Resources:

NCBI RefSeq record:
NM_004519.4
NBCI Gene record:
KCNQ3 (3786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004519.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445689 AGACGAGAATAGATATGATTT pLKO_005 2257 CDS 100% 13.200 18.480 N KCNQ3 n/a
2 TRCN0000044174 CCCTTCCAATAAGCCCATTTA pLKO.1 3161 CDS 100% 13.200 18.480 N KCNQ3 n/a
3 TRCN0000044177 CGACATGCTTTCCAGGATAAA pLKO.1 2228 CDS 100% 13.200 18.480 N KCNQ3 n/a
4 TRCN0000044176 GCGCATCCAAACTTTGATCTA pLKO.1 878 CDS 100% 4.950 3.960 N KCNQ3 n/a
5 TRCN0000069121 CCTGTGCATGTTGGACATCTT pLKO.1 1154 CDS 100% 4.950 3.465 N Kcnq3 n/a
6 TRCN0000044175 CCTCTGAATGTAGATGCCATA pLKO.1 1902 CDS 100% 4.050 2.835 N KCNQ3 n/a
7 TRCN0000044173 CCTTGTAATGTAGACAGACTT pLKO.1 3205 3UTR 100% 4.950 2.970 N KCNQ3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3899 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004519.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.