Transcript: Human NM_004533.4

Homo sapiens myosin binding protein C, fast type (MYBPC2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MYBPC2 (4606)
Length:
3604
CDS:
63..3488

Additional Resources:

NCBI RefSeq record:
NM_004533.4
NBCI Gene record:
MYBPC2 (4606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004533.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158905 CGTGGGCAATGAATACTATTT pLKO.1 3053 CDS 100% 13.200 18.480 N MYBPC2 n/a
2 TRCN0000164182 CCGAGTTTACACCGAGAACAT pLKO.1 3074 CDS 100% 4.950 6.930 N MYBPC2 n/a
3 TRCN0000163075 GATGAGGGAGACTACACGTTT pLKO.1 1572 CDS 100% 4.950 3.465 N MYBPC2 n/a
4 TRCN0000161630 GCAGAGTCTAGAAAGCTTCAA pLKO.1 548 CDS 100% 4.950 3.465 N MYBPC2 n/a
5 TRCN0000164327 CCACCAAAGATCCACTTGGAT pLKO.1 1674 CDS 100% 3.000 2.100 N MYBPC2 n/a
6 TRCN0000163388 GCAGCAGCTTTGTGATTGAGA pLKO.1 1861 CDS 100% 3.000 2.100 N MYBPC2 n/a
7 TRCN0000163840 CCAAGCAGCAAGTACGTGTTT pLKO.1 954 CDS 100% 4.950 2.970 N MYBPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004533.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.