Transcript: Human NM_004556.3

Homo sapiens NFKB inhibitor epsilon (NFKBIE), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
NFKBIE (4794)
Length:
2344
CDS:
206..1291

Additional Resources:

NCBI RefSeq record:
NM_004556.3
NBCI Gene record:
NFKBIE (4794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358895 TGAGAGGTGTCCCATCTTATT pLKO_005 1683 3UTR 100% 13.200 18.480 N NFKBIE n/a
2 TRCN0000358830 TTTCAGTAACATGACACTAAA pLKO_005 1782 3UTR 100% 13.200 18.480 N NFKBIE n/a
3 TRCN0000056834 AGAACCAACCACTCATGGAAT pLKO.1 930 CDS 100% 4.950 3.960 N NFKBIE n/a
4 TRCN0000358897 CAGCTGGAAGCACTCACTTAC pLKO_005 530 CDS 100% 10.800 7.560 N NFKBIE n/a
5 TRCN0000358831 TTCGGAATGGAGCTGACATTG pLKO_005 957 CDS 100% 10.800 7.560 N NFKBIE n/a
6 TRCN0000056833 CTTCGGAATGGAGCTGACATT pLKO.1 956 CDS 100% 4.950 3.465 N NFKBIE n/a
7 TRCN0000056835 CATCTCATCCACTCTGTGCAA pLKO.1 1141 CDS 100% 2.640 1.848 N NFKBIE n/a
8 TRCN0000056837 AGCCAGTACGACTCTGGCATT pLKO.1 245 CDS 100% 0.405 0.284 N NFKBIE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.