Transcript: Human NM_004609.3

Homo sapiens transcription factor 15 (TCF15), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TCF15 (6939)
Length:
1227
CDS:
30..629

Additional Resources:

NCBI RefSeq record:
NM_004609.3
NBCI Gene record:
TCF15 (6939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015254 TCAGAGCGTGAACACGGCCTT pLKO.1 284 CDS 100% 0.720 1.008 N TCF15 n/a
2 TRCN0000015257 CGACGCGTCGGACCAGTCGTT pLKO.1 122 CDS 100% 0.000 0.000 N TCF15 n/a
3 TRCN0000433662 TCGTTCTGAGCTGAGGAGAGT pLKO_005 968 3UTR 100% 2.640 2.112 N TCF15 n/a
4 TRCN0000015256 GCACGTGCTGTACCCGGACGT pLKO.1 62 CDS 100% 0.000 0.000 N TCF15 n/a
5 TRCN0000434177 GAGAGCTGTGAGGATCCATTC pLKO_005 791 3UTR 100% 6.000 4.200 N TCF15 n/a
6 TRCN0000419689 GTGTGTATCTGTGCGTGAGTG pLKO_005 886 3UTR 100% 4.050 2.835 N TCF15 n/a
7 TRCN0000423536 CAAAGACTGTTGGTGACAGGG pLKO_005 862 3UTR 100% 2.160 1.512 N TCF15 n/a
8 TRCN0000085021 CGCGCTCCATCTGCACCTTCT pLKO.1 511 CDS 100% 0.000 0.000 N Tcf15 n/a
9 TRCN0000015253 GTCAGAGACAAGGCAGAACTT pLKO.1 832 3UTR 100% 4.950 2.970 N TCF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.