Transcript: Human NM_004638.4

Homo sapiens proline rich coiled-coil 2A (PRRC2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PRRC2A (7916)
Length:
6903
CDS:
245..6718

Additional Resources:

NCBI RefSeq record:
NM_004638.4
NBCI Gene record:
PRRC2A (7916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236163 GTGGAGCCGTACCAGGTATTT pLKO_005 4320 CDS 100% 13.200 18.480 N PRRC2A n/a
2 TRCN0000245343 CAACCTGTTTGATACGTATAA pLKO_005 304 CDS 100% 13.200 9.240 N Prrc2a n/a
3 TRCN0000236160 CTATTCTCAAAGAGGATAATC pLKO_005 1158 CDS 100% 13.200 9.240 N PRRC2A n/a
4 TRCN0000236162 GGGAGCCATGGACTCTCAATT pLKO_005 5794 CDS 100% 13.200 9.240 N PRRC2A n/a
5 TRCN0000236159 CCTCACATCTGGAACCGTTTA pLKO_005 5066 CDS 100% 10.800 7.560 N PRRC2A n/a
6 TRCN0000236161 TCCGCAGTTACCGAGAGTTTC pLKO_005 3405 CDS 100% 10.800 7.560 N PRRC2A n/a
7 TRCN0000184389 CCTCGCTCAACCTGTTTGATA pLKO.1 297 CDS 100% 5.625 3.938 N PRRC2A n/a
8 TRCN0000195860 CCACAATCCAAGAACCTGGAT pLKO.1 5675 CDS 100% 0.264 0.185 N PRRC2A n/a
9 TRCN0000245346 GGGCTTGTATATAGATTATAA pLKO_005 6746 3UTR 100% 15.000 7.500 Y Prrc2a n/a
10 TRCN0000099504 CCCATGAAGAGGTTGACTATA pLKO.1 1230 CDS 100% 13.200 9.240 N Prrc2a n/a
11 TRCN0000245344 CCCATGAAGAGGTTGACTATA pLKO_005 1230 CDS 100% 13.200 9.240 N Prrc2a n/a
12 TRCN0000099500 GCCCATGAAGAGGTTGACTAT pLKO.1 1229 CDS 100% 4.950 3.465 N Prrc2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.