Transcript: Human NM_004646.3

Homo sapiens NPHS1 adhesion molecule, nephrin (NPHS1), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NPHS1 (4868)
Length:
5024
CDS:
157..3882

Additional Resources:

NCBI RefSeq record:
NM_004646.3
NBCI Gene record:
NPHS1 (4868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084009 GCTCCGTCTTGTTGTCAGATT pLKO.1 2643 CDS 100% 4.950 3.960 N NPHS1 n/a
2 TRCN0000084011 GCCATTATTATCTTGGGATCT pLKO.1 1180 CDS 100% 4.050 3.240 N NPHS1 n/a
3 TRCN0000084012 CACTTGTATGATGAGGTAGAA pLKO.1 3676 CDS 100% 4.950 3.465 N NPHS1 n/a
4 TRCN0000084010 GCCTCATTCACCGTGAATGTT pLKO.1 844 CDS 100% 0.563 0.394 N NPHS1 n/a
5 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 4235 3UTR 100% 10.800 5.400 Y SMIM11A n/a
6 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 4169 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.