Transcript: Human NM_004687.5

Homo sapiens myotubularin related protein 4 (MTMR4), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MTMR4 (9110)
Length:
5814
CDS:
101..3688

Additional Resources:

NCBI RefSeq record:
NM_004687.5
NBCI Gene record:
MTMR4 (9110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004687.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002992 CCAGCATAGGTTACGGCAAAT pLKO.1 3163 CDS 100% 10.800 15.120 N MTMR4 n/a
2 TRCN0000279997 CCAGCATAGGTTACGGCAAAT pLKO_005 3163 CDS 100% 10.800 15.120 N MTMR4 n/a
3 TRCN0000002994 GAGCCGTGATATGTTCCAGTT pLKO.1 340 CDS 100% 4.050 5.670 N MTMR4 n/a
4 TRCN0000279996 GAGCCGTGATATGTTCCAGTT pLKO_005 340 CDS 100% 4.050 5.670 N MTMR4 n/a
5 TRCN0000002993 CCCTGCCTGTTTGAATTTAAT pLKO.1 1553 CDS 100% 15.000 10.500 N MTMR4 n/a
6 TRCN0000279998 CCCTGCCTGTTTGAATTTAAT pLKO_005 1553 CDS 100% 15.000 10.500 N MTMR4 n/a
7 TRCN0000280071 TAATAGGAATGGGCAGTTATT pLKO_005 2704 CDS 100% 13.200 9.240 N MTMR4 n/a
8 TRCN0000002995 CCTCTGTATTTGGATGATGAT pLKO.1 3116 CDS 100% 4.950 3.465 N MTMR4 n/a
9 TRCN0000002991 GCTGTCTATTTCTGTGCACTT pLKO.1 4793 3UTR 100% 4.050 2.430 N MTMR4 n/a
10 TRCN0000280067 GCTGTCTATTTCTGTGCACTT pLKO_005 4793 3UTR 100% 4.050 2.430 N MTMR4 n/a
11 TRCN0000080580 GCCAGATCAGTGAGTTCTCAT pLKO.1 2784 CDS 100% 4.950 6.930 N Mtmr4 n/a
12 TRCN0000080579 CGGATGATTGACAGTGTGGAA pLKO.1 320 CDS 100% 2.640 1.848 N Mtmr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004687.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.