Transcript: Human NM_004717.3

Homo sapiens diacylglycerol kinase iota (DGKI), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DGKI (9162)
Length:
6770
CDS:
3..3200

Additional Resources:

NCBI RefSeq record:
NM_004717.3
NBCI Gene record:
DGKI (9162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145664 AGATCGCTGGAACCTCCATG pXPR_003 TGG 1507 47% 14 0.5171 DGKI DGKI 76614
2 BRDN0001147313 GCGACTTTGGACTGGAGTGT pXPR_003 AGG 509 16% 2 0.4825 DGKI DGKI 76616
3 BRDN0001147613 CTTCACCTTAATGATCCAAG pXPR_003 TGG 967 30% 8 -0.0464 DGKI DGKI 76615
4 BRDN0001144797 AAACCAACATTTCGAGAAGG pXPR_003 AGG 713 22% 5 -0.7167 DGKI DGKI 76613
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199386 CCACGGACCTTCCGAGTTATT pLKO.1 2942 CDS 100% 13.200 18.480 N DGKI n/a
2 TRCN0000006090 CGTCAGAACTATAAGGTCATT pLKO.1 3150 CDS 100% 4.950 6.930 N DGKI n/a
3 TRCN0000006089 GCGCTTGAATTGTATAGGAAA pLKO.1 1251 CDS 100% 4.950 3.960 N DGKI n/a
4 TRCN0000194955 CAAAGGATGTTCGTATAAATG pLKO.1 3513 3UTR 100% 13.200 9.240 N DGKI n/a
5 TRCN0000195261 CATTGGAATCTAGCCAGAAAT pLKO.1 4613 3UTR 100% 13.200 9.240 N DGKI n/a
6 TRCN0000195402 CAGGAAATGGAGCACTCTAAC pLKO.1 4151 3UTR 100% 10.800 7.560 N DGKI n/a
7 TRCN0000195422 CCTGCATTGAGCAGCTAGAAA pLKO.1 661 CDS 100% 5.625 3.938 N DGKI n/a
8 TRCN0000010994 CCCTATTATGAGGACTCAGAT pLKO.1 2709 CDS 100% 4.950 3.465 N DGKI n/a
9 TRCN0000006088 GCACCCTAATTGACTTGGAAA pLKO.1 4210 3UTR 100% 4.950 3.465 N DGKI n/a
10 TRCN0000006091 CCAGATATTGTGCTGGCACAA pLKO.1 1834 CDS 100% 0.405 0.284 N DGKI n/a
11 TRCN0000025391 TGGATCATTAAGGTGAAGAAA pLKO.1 969 CDS 100% 5.625 3.375 N LOC381757 n/a
12 TRCN0000221692 CCTCTGGGTATTCTAGTTGTT pLKO.1 2310 CDS 100% 4.950 3.465 N Dgki n/a
13 TRCN0000025389 CCTGCTTCATGCTGCATCATA pLKO.1 895 CDS 100% 5.625 3.375 N LOC381757 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.