Transcript: Human NM_004770.3

Homo sapiens potassium voltage-gated channel subfamily B member 2 (KCNB2), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
KCNB2 (9312)
Length:
3748
CDS:
755..3490

Additional Resources:

NCBI RefSeq record:
NM_004770.3
NBCI Gene record:
KCNB2 (9312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428245 TGCAGGAAACGGACGAATTTG pLKO_005 1407 CDS 100% 13.200 18.480 N KCNB2 n/a
2 TRCN0000045002 CGACTATAATCTGAACGAGAA pLKO.1 988 CDS 100% 4.050 5.670 N KCNB2 n/a
3 TRCN0000044998 GCGATTCTTATCCTCACCAAA pLKO.1 1504 CDS 100% 4.950 3.960 N KCNB2 n/a
4 TRCN0000435909 CATCGTTTCTATGAACTTAAA pLKO_005 2098 CDS 100% 13.200 9.240 N KCNB2 n/a
5 TRCN0000044999 GCTCGAAGTATGGAACTGATA pLKO.1 2129 CDS 100% 4.950 3.465 N KCNB2 n/a
6 TRCN0000045000 GCTGTGTGTATTGCATGGTTT pLKO.1 1466 CDS 100% 4.950 3.465 N KCNB2 n/a
7 TRCN0000045001 CCAAGCAGAAACTGTTCCCTT pLKO.1 3120 CDS 100% 2.640 1.848 N KCNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.