Transcript: Human NM_004771.4

Homo sapiens matrix metallopeptidase 20 (MMP20), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MMP20 (9313)
Length:
1959
CDS:
14..1465

Additional Resources:

NCBI RefSeq record:
NM_004771.4
NBCI Gene record:
MMP20 (9313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417568 GAGATACACATTTCGACAATG pLKO_005 615 CDS 100% 10.800 15.120 N MMP20 n/a
2 TRCN0000051333 CCAGACCACAATGAACGTGAT pLKO.1 277 CDS 100% 4.050 5.670 N MMP20 n/a
3 TRCN0000413011 GTGGATTCCATGACATATATT pLKO_005 1797 3UTR 100% 15.000 12.000 N MMP20 n/a
4 TRCN0000051336 CCCAACTTATAAGTACAAGAA pLKO.1 748 CDS 100% 4.950 3.960 N MMP20 n/a
5 TRCN0000425076 TGCAGTTAGACACCATTATTT pLKO_005 1710 3UTR 100% 15.000 10.500 N MMP20 n/a
6 TRCN0000221437 GCACTGATGTACCCAACTTAT pLKO.1 737 CDS 100% 13.200 9.240 N Mmp20 n/a
7 TRCN0000051335 CCAAAGAATACTGAAGAAGAA pLKO.1 1298 CDS 100% 4.950 3.465 N MMP20 n/a
8 TRCN0000051334 GCACAGGCGTATCTTGACAAA pLKO.1 134 CDS 100% 4.950 3.465 N MMP20 n/a
9 TRCN0000051337 GTCAGAATAAACTCAGGAGAA pLKO.1 485 CDS 100% 4.050 2.835 N MMP20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.