Transcript: Human NM_004789.4

Homo sapiens LIM homeobox 2 (LHX2), mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
LHX2 (9355)
Length:
2396
CDS:
582..1802

Additional Resources:

NCBI RefSeq record:
NM_004789.4
NBCI Gene record:
LHX2 (9355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431242 CAACTGTGACGTCCGTCTTAA pLKO_005 1708 CDS 100% 13.200 18.480 N LHX2 n/a
2 TRCN0000013420 GCAACCTCTTACGGCAGGAAA pLKO.1 1549 CDS 100% 4.950 6.930 N LHX2 n/a
3 TRCN0000427311 AGACTACTACAGGCGCTTCTC pLKO_005 893 CDS 100% 4.050 5.670 N LHX2 n/a
4 TRCN0000422239 CAAGATCTCGGACCGCTACTA pLKO_005 755 CDS 100% 4.950 3.465 N LHX2 n/a
5 TRCN0000013418 CCGAGGAACAACTTGGAAGAT pLKO.1 1977 3UTR 100% 4.950 3.465 N LHX2 n/a
6 TRCN0000070533 CGTGCCTTAGGAATACTGTTT pLKO.1 2106 3UTR 100% 4.950 3.465 N Lhx2 n/a
7 TRCN0000013419 GCTTCGGACCATGAAGTCTTA pLKO.1 1412 CDS 100% 4.950 3.465 N LHX2 n/a
8 TRCN0000013422 GTGCACCACGTGTAACAAGAT pLKO.1 1007 CDS 100% 4.950 3.465 N LHX2 n/a
9 TRCN0000416449 ACTTGAAGCAGCTCGCGCAAA pLKO_005 1465 CDS 100% 4.050 2.835 N LHX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.