Transcript: Human NM_004798.4

Homo sapiens kinesin family member 3B (KIF3B), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KIF3B (9371)
Length:
6116
CDS:
181..2424

Additional Resources:

NCBI RefSeq record:
NM_004798.4
NBCI Gene record:
KIF3B (9371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004798.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116460 GCTCGCGTTCTCATGCAATTT pLKO.1 815 CDS 100% 13.200 18.480 N KIF3B n/a
2 TRCN0000289788 GCTCGCGTTCTCATGCAATTT pLKO_005 815 CDS 100% 13.200 18.480 N KIF3B n/a
3 TRCN0000296385 TTCGTCCAGAGGCCCGATATA pLKO_005 2126 CDS 100% 13.200 18.480 N KIF3B n/a
4 TRCN0000116458 CCTGCCTCTTACAACGTAGAA pLKO.1 1135 CDS 100% 4.950 6.930 N KIF3B n/a
5 TRCN0000289723 CCTGCCTCTTACAACGTAGAA pLKO_005 1135 CDS 100% 4.950 6.930 N KIF3B n/a
6 TRCN0000116459 GCACGCAAGAATGTCCATGAT pLKO.1 2103 CDS 100% 4.950 6.930 N KIF3B n/a
7 TRCN0000296386 AGTCTCAGCCGTGGGATATAA pLKO_005 2067 CDS 100% 15.000 10.500 N KIF3B n/a
8 TRCN0000116457 GCCTGTTTGAATAAGAACAAA pLKO.1 4296 3UTR 100% 5.625 3.938 N KIF3B n/a
9 TRCN0000289787 GCCTGTTTGAATAAGAACAAA pLKO_005 4296 3UTR 100% 5.625 3.938 N KIF3B n/a
10 TRCN0000116461 CTTGGAACTTAAAGAGACATA pLKO.1 1740 CDS 100% 4.950 3.465 N KIF3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004798.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.