Transcript: Human NM_004922.4

Homo sapiens SEC24 homolog C, COPII coat complex component (SEC24C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SEC24C (9632)
Length:
4532
CDS:
182..3466

Additional Resources:

NCBI RefSeq record:
NM_004922.4
NBCI Gene record:
SEC24C (9632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004922.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381081 CACCCAGACCCTGGCAATATT pLKO_005 3762 3UTR 100% 15.000 21.000 N SEC24C n/a
2 TRCN0000380070 GAAATTGGGACAGTAACATAT pLKO_005 3529 3UTR 100% 13.200 18.480 N SEC24C n/a
3 TRCN0000065160 CCTTTGACAAAGTCTCCCGTT pLKO.1 3038 CDS 100% 2.160 1.728 N SEC24C n/a
4 TRCN0000381549 CACCCAGCTGGCTGATCTATA pLKO_005 2677 CDS 100% 13.200 9.240 N SEC24C n/a
5 TRCN0000381332 GCTAAAGCAAGTGGGTAAATG pLKO_005 3462 CDS 100% 13.200 9.240 N SEC24C n/a
6 TRCN0000380441 CACTGTATATGATTCGGTATT pLKO_005 3728 3UTR 100% 10.800 7.560 N SEC24C n/a
7 TRCN0000065159 CCCTTCATGCAGTTCATTGAA pLKO.1 1481 CDS 100% 5.625 3.938 N SEC24C n/a
8 TRCN0000300152 CCCTTCATGCAGTTCATTGAA pLKO_005 1481 CDS 100% 5.625 3.938 N SEC24C n/a
9 TRCN0000065161 CCAAGCCCTATTCAGGTCATT pLKO.1 1160 CDS 100% 4.950 3.465 N SEC24C n/a
10 TRCN0000300219 CCAAGCCCTATTCAGGTCATT pLKO_005 1160 CDS 100% 4.950 3.465 N SEC24C n/a
11 TRCN0000065162 GCATGAAGCTACTCCCAGTTT pLKO.1 2880 CDS 100% 4.950 3.465 N SEC24C n/a
12 TRCN0000300220 GCATGAAGCTACTCCCAGTTT pLKO_005 2880 CDS 100% 4.950 3.465 N SEC24C n/a
13 TRCN0000065158 GCTCCACTGTTCAGATGCAAA pLKO.1 468 CDS 100% 4.950 3.465 N SEC24C n/a
14 TRCN0000300153 GCTCCACTGTTCAGATGCAAA pLKO_005 468 CDS 100% 4.950 3.465 N SEC24C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004922.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.