Transcript: Human NM_005040.4

Homo sapiens prolylcarboxypeptidase (PRCP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PRCP (5547)
Length:
3489
CDS:
29..1519

Additional Resources:

NCBI RefSeq record:
NM_005040.4
NBCI Gene record:
PRCP (5547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050812 CGGTACCTAGTAGCTGATAAA pLKO.1 239 CDS 100% 0.000 0.000 N PRCP n/a
2 TRCN0000301107 CGGTACCTAGTAGCTGATAAA pLKO_005 239 CDS 100% 0.000 0.000 N PRCP n/a
3 TRCN0000050809 CGCCTGGTTTAGGATGAAATA pLKO.1 583 CDS 100% 13.200 9.240 N PRCP n/a
4 TRCN0000050808 GCCAGGTGAAATGCCTGAATA pLKO.1 1044 CDS 100% 13.200 9.240 N PRCP n/a
5 TRCN0000323388 TTAGTACCTTGTGGTGTATTT pLKO_005 662 CDS 100% 13.200 9.240 N PRCP n/a
6 TRCN0000050811 GCTCCTTGGAAGTTAGACATA pLKO.1 1449 CDS 100% 4.950 3.465 N PRCP n/a
7 TRCN0000301030 GCTCCTTGGAAGTTAGACATA pLKO_005 1449 CDS 100% 4.950 3.465 N PRCP n/a
8 TRCN0000050810 CCCATTAACTTCTCAGGACAT pLKO.1 823 CDS 100% 4.050 2.835 N PRCP n/a
9 TRCN0000323311 CACCATCAGTGGCCCTCATAA pLKO_005 1755 3UTR 100% 13.200 7.920 N PRCP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.