Transcript: Human NM_005082.5

Homo sapiens tripartite motif containing 25 (TRIM25), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRIM25 (7706)
Length:
5745
CDS:
62..1954

Additional Resources:

NCBI RefSeq record:
NM_005082.5
NBCI Gene record:
TRIM25 (7706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005082.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272697 CCGGAACAGTTAGTGGATTTA pLKO_005 1286 CDS 100% 13.200 18.480 N TRIM25 n/a
2 TRCN0000003449 GTGCCCGATTCCTCTTAGAGA pLKO.1 2260 3UTR 100% 3.000 4.200 N TRIM25 n/a
3 TRCN0000272650 GTGCCCGATTCCTCTTAGAGA pLKO_005 2260 3UTR 100% 3.000 4.200 N TRIM25 n/a
4 TRCN0000003447 ACAACAAGAATACACGGAAAT pLKO.1 784 CDS 100% 10.800 8.640 N TRIM25 n/a
5 TRCN0000272699 GATCTCTGCCTGGCACAATAA pLKO_005 1732 CDS 100% 13.200 9.240 N TRIM25 n/a
6 TRCN0000003446 CCAGCTCACATCCGAACTCAA pLKO.1 1341 CDS 100% 4.950 3.465 N TRIM25 n/a
7 TRCN0000003448 GAACTGAACCACAAGCTGATA pLKO.1 1043 CDS 100% 4.950 3.465 N TRIM25 n/a
8 TRCN0000272698 GAACTGAACCACAAGCTGATA pLKO_005 1043 CDS 100% 4.950 3.465 N TRIM25 n/a
9 TRCN0000003445 GAGTGAGATCCAGACCTTGAA pLKO.1 916 CDS 100% 4.950 3.465 N TRIM25 n/a
10 TRCN0000272649 GAGTGAGATCCAGACCTTGAA pLKO_005 916 CDS 100% 4.950 3.465 N TRIM25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005082.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.