Transcript: Human NM_005118.4

Homo sapiens TNF superfamily member 15 (TNFSF15), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TNFSF15 (9966)
Length:
6583
CDS:
28..783

Additional Resources:

NCBI RefSeq record:
NM_005118.4
NBCI Gene record:
TNFSF15 (9966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005118.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373795 ATTAAGACACTGATCACTAAA pLKO_005 1042 3UTR 100% 13.200 18.480 N TNFSF15 n/a
2 TRCN0000058902 GTCGGGAGACTACTTCATTTA pLKO.1 456 CDS 100% 13.200 18.480 N TNFSF15 n/a
3 TRCN0000058900 GAACCGAATGAACTATACCAA pLKO.1 414 CDS 100% 3.000 4.200 N TNFSF15 n/a
4 TRCN0000373794 ACTATAGGAGGAGAGCAAATA pLKO_005 777 CDS 100% 13.200 9.240 N TNFSF15 n/a
5 TRCN0000058901 CACCAAGGTAACAGACAGCTA pLKO.1 570 CDS 100% 2.640 1.848 N TNFSF15 n/a
6 TRCN0000058899 GCCATGTTCTCCTTGCAAGAA pLKO.1 673 CDS 100% 4.950 2.970 N TNFSF15 n/a
7 TRCN0000058898 CAGCAAGTTTATGCACCTCTT pLKO.1 271 CDS 100% 4.050 2.430 N TNFSF15 n/a
8 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 4560 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005118.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.