Transcript: Human NM_005120.3

Homo sapiens mediator complex subunit 12 (MED12), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MED12 (9968)
Length:
6925
CDS:
160..6693

Additional Resources:

NCBI RefSeq record:
NM_005120.3
NBCI Gene record:
MED12 (9968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235562 TTCGCTGGTCTTTCGATAAAT pLKO_005 1469 CDS 100% 15.000 21.000 N MED12 n/a
2 TRCN0000235565 ATGATCCCGATAGGGTGAATG pLKO_005 3356 CDS 100% 10.800 15.120 N MED12 n/a
3 TRCN0000018575 GCTGTTCTCAAGGCTGTGTTT pLKO.1 3823 CDS 100% 4.950 3.960 N MED12 n/a
4 TRCN0000018576 CGGGTACTTCATACTTTGGAA pLKO.1 1522 CDS 100% 3.000 2.400 N MED12 n/a
5 TRCN0000235566 AGATCATCACCAAGTACTTAT pLKO_005 722 CDS 100% 13.200 9.240 N MED12 n/a
6 TRCN0000235563 CACAGCCCAGTACCAACATAT pLKO_005 6659 CDS 100% 13.200 9.240 N MED12 n/a
7 TRCN0000235564 CCCACCCTTTCCTCTTAATTC pLKO_005 6730 3UTR 100% 13.200 9.240 N MED12 n/a
8 TRCN0000018578 GCAGAGAAATTACGTTGTAAT pLKO.1 391 CDS 100% 13.200 9.240 N MED12 n/a
9 TRCN0000018574 GCAGCATTATTGCAGAGAAAT pLKO.1 380 CDS 100% 13.200 9.240 N MED12 n/a
10 TRCN0000096465 GCTCCTATTGTGCCTCTGAAT pLKO.1 2539 CDS 100% 4.950 3.465 N Med12 n/a
11 TRCN0000018577 GCAGTTCATCTTCGACCTCAT pLKO.1 2778 CDS 100% 4.050 2.835 N MED12 n/a
12 TRCN0000096468 CCTCTCCCTTTGATGATCCTA pLKO.1 2060 CDS 100% 3.000 2.100 N Med12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.