Transcript: Human NM_005149.3

Homo sapiens T-box transcription factor 19 (TBX19), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TBX19 (9095)
Length:
2985
CDS:
215..1561

Additional Resources:

NCBI RefSeq record:
NM_005149.3
NBCI Gene record:
TBX19 (9095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231043 ATAACTGGGTGTGGTAGTTTA pLKO_005 2188 3UTR 100% 13.200 18.480 N TBX19 n/a
2 TRCN0000084191 CCCTCAGTGAATTTGATAGAA pLKO.1 1124 CDS 100% 5.625 7.875 N Tbx19 n/a
3 TRCN0000419188 AGATTCAAGGAAGTCACTAAT pLKO_005 371 CDS 100% 13.200 9.240 N Tbx19 n/a
4 TRCN0000218481 CCTATCAGAATGAGGAGATAA pLKO_005 801 CDS 100% 13.200 9.240 N TBX19 n/a
5 TRCN0000231041 AGAATGGCAGACGGATGTTTC pLKO_005 408 CDS 100% 10.800 7.560 N TBX19 n/a
6 TRCN0000218558 GAAACTCCAATTACCAGTATG pLKO_005 987 CDS 100% 10.800 7.560 N TBX19 n/a
7 TRCN0000013354 CCTCAGTGAATTTGATAGAAA pLKO.1 1125 CDS 100% 5.625 3.938 N TBX19 n/a
8 TRCN0000013356 GAAGTCACTAATGAGATGATT pLKO.1 380 CDS 100% 5.625 3.938 N TBX19 n/a
9 TRCN0000013357 GACGGATGTTTCCAGTCCTAA pLKO.1 417 CDS 100% 4.950 3.465 N TBX19 n/a
10 TRCN0000013355 GCCAAGGAAAGAAATCACCTA pLKO.1 869 CDS 100% 2.640 1.848 N TBX19 n/a
11 TRCN0000013353 CCCTGCCTCTTATTCTCAAAT pLKO.1 1843 3UTR 100% 13.200 7.920 N TBX19 n/a
12 TRCN0000231042 CCATGGCTGTGAGCACTATTC pLKO_005 1042 CDS 100% 10.800 6.480 N TBX19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.