Transcript: Human NM_005164.4

Homo sapiens ATP binding cassette subfamily D member 2 (ABCD2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ABCD2 (225)
Length:
6290
CDS:
189..2411

Additional Resources:

NCBI RefSeq record:
NM_005164.4
NBCI Gene record:
ABCD2 (225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005164.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423349 CTTTACCACTGCTCGAAATTT pLKO_005 1352 CDS 100% 15.000 21.000 N ABCD2 n/a
2 TRCN0000105346 CCTCGGACTTTCATCATCAAA pLKO.1 606 CDS 100% 5.625 7.875 N Abcd2 n/a
3 TRCN0000059449 CGTTTGACATTGAGTGAAGAA pLKO.1 2265 CDS 100% 4.950 6.930 N ABCD2 n/a
4 TRCN0000421825 AGTGACACATTGGCAATTAAA pLKO_005 1572 CDS 100% 15.000 12.000 N ABCD2 n/a
5 TRCN0000281572 CATCATTGGCAAGCGTTTAAA pLKO_005 302 CDS 100% 15.000 12.000 N Abcd2 n/a
6 TRCN0000413626 CATCATTGGCAAGCGTTTAAA pLKO_005 302 CDS 100% 15.000 12.000 N ABCD2 n/a
7 TRCN0000059451 CGGACTTTCATCATCAAATTA pLKO.1 609 CDS 100% 15.000 12.000 N ABCD2 n/a
8 TRCN0000430233 GGAGCAGCAGTGGACTAATTA pLKO_005 1243 CDS 100% 15.000 10.500 N ABCD2 n/a
9 TRCN0000059452 CCCTGATTCAGTGGATGATAT pLKO.1 1877 CDS 100% 13.200 9.240 N ABCD2 n/a
10 TRCN0000105349 TCGGACTTTCATCATCAAATT pLKO.1 608 CDS 100% 13.200 9.240 N Abcd2 n/a
11 TRCN0000059448 CCAATCTCTTACGGAGGATAT pLKO.1 809 CDS 100% 10.800 7.560 N ABCD2 n/a
12 TRCN0000059450 GCAGATCAGATGAACCTCATT pLKO.1 1167 CDS 100% 4.950 3.465 N ABCD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005164.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.