Transcript: Human NM_005225.3

Homo sapiens E2F transcription factor 1 (E2F1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
E2F1 (1869)
Length:
2690
CDS:
122..1435

Additional Resources:

NCBI RefSeq record:
NM_005225.3
NBCI Gene record:
E2F1 (1869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039659 CGCTATGAGACCTCACTGAAT pLKO.1 500 CDS 100% 4.950 6.930 N E2F1 n/a
2 TRCN0000332897 CGCTATGAGACCTCACTGAAT pLKO_005 500 CDS 100% 4.950 6.930 N E2F1 n/a
3 TRCN0000000250 GACCTCTTCGACTGTGACTTT pLKO.1 1388 CDS 100% 4.950 6.930 N E2F1 n/a
4 TRCN0000000249 TAACTGCACTTTCGGCCCTTT pLKO.1 1817 3UTR 100% 4.050 5.670 N E2F1 n/a
5 TRCN0000000252 TAAGAGCAAACAAGGCCCGAT pLKO.1 979 CDS 100% 2.160 3.024 N E2F1 n/a
6 TRCN0000000253 ACCTCTTCGACTGTGACTTTG pLKO.1 1389 CDS 100% 10.800 8.640 N E2F1 n/a
7 TRCN0000344500 ACCTCTTCGACTGTGACTTTG pLKO_005 1389 CDS 100% 10.800 8.640 N E2F1 n/a
8 TRCN0000039661 ACCTGATGAATATCTGTACTA pLKO.1 786 CDS 100% 4.950 3.465 N E2F1 n/a
9 TRCN0000332898 ACCTGATGAATATCTGTACTA pLKO_005 786 CDS 100% 4.950 3.465 N E2F1 n/a
10 TRCN0000000251 CATCCAGCTCATTGCCAAGAA pLKO.1 649 CDS 100% 4.950 3.465 N E2F1 n/a
11 TRCN0000039660 CGTGGACTCTTCGGAGAACTT pLKO.1 946 CDS 100% 4.950 3.465 N E2F1 n/a
12 TRCN0000332963 CGTGGACTCTTCGGAGAACTT pLKO_005 946 CDS 100% 4.950 3.465 N E2F1 n/a
13 TRCN0000010327 GACATCACCAACGTCCTTGAG pLKO.1 626 CDS 100% 4.050 2.835 N E2F1 n/a
14 TRCN0000039662 CCTGAGGAGTTCATCAGCCTT pLKO.1 1307 CDS 100% 2.640 1.848 N E2F1 n/a
15 TRCN0000039658 CAGGATGGATATGAGATGGGA pLKO.1 2262 3UTR 100% 0.750 0.525 N E2F1 n/a
16 TRCN0000332899 CAGGATGGATATGAGATGGGA pLKO_005 2262 3UTR 100% 0.750 0.525 N E2F1 n/a
17 TRCN0000010328 CTACTCAGCCTGGAGCAAGAA pLKO.1 1169 CDS 100% 4.950 2.970 N E2F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.