Transcript: Human NM_005245.4

Homo sapiens FAT atypical cadherin 1 (FAT1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FAT1 (2195)
Length:
14776
CDS:
212..13978

Additional Resources:

NCBI RefSeq record:
NM_005245.4
NBCI Gene record:
FAT1 (2195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005245.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245156 AGTGATCTCAGTCCGTTTAAT pLKO_005 7897 CDS 100% 15.000 21.000 N FAT1 n/a
2 TRCN0000245158 AGTTCTCCATTAACGAATTAT pLKO_005 9723 CDS 100% 15.000 21.000 N FAT1 n/a
3 TRCN0000038025 CCGGCATATAAGCTGAGCATA pLKO.1 6953 CDS 100% 4.950 6.930 N FAT1 n/a
4 TRCN0000038026 GCCGTATTTATCATTGAGAAT pLKO.1 10067 CDS 100% 4.950 6.930 N FAT1 n/a
5 TRCN0000245157 AGATGCCGACGCAGGATTAAA pLKO_005 9661 CDS 100% 15.000 10.500 N FAT1 n/a
6 TRCN0000245155 CGTTACCGACCTCAATGATAA pLKO_005 7348 CDS 100% 13.200 9.240 N FAT1 n/a
7 TRCN0000038028 GCCCATTTACACATTGATAAT pLKO.1 5401 CDS 100% 13.200 9.240 N FAT1 n/a
8 TRCN0000245159 CTCTGGACGTGCTAGCCATTT pLKO_005 14113 3UTR 100% 10.800 7.560 N FAT1 n/a
9 TRCN0000038027 GCCTGTTTATTACCCAGAAAT pLKO.1 3634 CDS 100% 13.200 7.920 N FAT1 n/a
10 TRCN0000038024 CCAGGGTTTCATTCTGTCTTT pLKO.1 14448 3UTR 100% 4.950 2.970 N FAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005245.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.