Transcript: Human NM_005315.1

Homo sapiens goosecoid homeobox 2 (GSC2), mRNA.

Source:
NCBI, updated 2019-09-05
Taxon:
Homo sapiens (human)
Gene:
GSC2 (2928)
Length:
618
CDS:
1..618

Additional Resources:

NCBI RefSeq record:
NM_005315.1
NBCI Gene record:
GSC2 (2928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020529 ACCAGTATCCTGACGTGAGTA pLKO.1 443 CDS 100% 4.950 3.465 N GSC2 n/a
2 TRCN0000020533 CGTGCAGAACCAGTATCCTGA pLKO.1 435 CDS 100% 2.640 1.848 N GSC2 n/a
3 TRCN0000020530 CCGCACCATCTTCAGCGAAGA pLKO.1 387 CDS 100% 1.350 0.945 N GSC2 n/a
4 TRCN0000020532 CCATCGAGCACATCCTCTCCA pLKO.1 62 CDS 100% 0.880 0.616 N GSC2 n/a
5 TRCN0000020531 CCCTTGTCTCTGGGTGCGCCA pLKO.1 301 CDS 100% 0.000 0.000 N GSC2 n/a
6 TRCN0000096419 CGCCTGCTGCTGCTGCTGCAA pLKO.1 192 CDS 100% 0.000 0.000 Y Gsc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.