Transcript: Human NM_005367.7

Homo sapiens MAGE family member A12 (MAGEA12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAGEA12 (4111)
Length:
1686
CDS:
179..1123

Additional Resources:

NCBI RefSeq record:
NM_005367.7
NBCI Gene record:
MAGEA12 (4111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005367.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435610 AGACGAGCTTCCAAGTAGCAC pLKO_005 483 CDS 100% 2.640 3.696 N MAGEA12 n/a
2 TRCN0000434071 GAGTGTGTTGGAGGCATCTGA pLKO_005 853 CDS 100% 3.000 2.100 N MAGEA12 n/a
3 TRCN0000143054 CAACTATACTCTCTGGAGTCA pLKO.1 403 CDS 100% 2.640 1.848 N MAGEA12 n/a
4 TRCN0000143830 CCATCAACTATACTCTCTGGA pLKO.1 399 CDS 100% 2.640 1.848 N MAGEA12 n/a
5 TRCN0000415656 GACAAATAACAGCAGTGGAAA pLKO_005 1478 3UTR 100% 4.950 2.970 N MAGEA12 n/a
6 TRCN0000435819 GATAATCGTCCTGGCCATAAT pLKO_005 784 CDS 100% 13.200 6.600 Y MAGEA2 n/a
7 TRCN0000153016 GCCCATTCTTCACTCTTTGAA pLKO.1 1225 3UTR 100% 5.625 2.813 Y MAGEA6 n/a
8 TRCN0000166663 CCCAAGATTTGGTGCAGGAAA pLKO.1 918 CDS 100% 4.950 2.475 Y MAGEA1 n/a
9 TRCN0000143087 CGTTGAAACCAGCTATGTGAA pLKO.1 1012 CDS 100% 4.950 2.475 Y MAGEA12 n/a
10 TRCN0000128375 GAATGACAGTAGTCACACATA pLKO.1 1380 3UTR 100% 4.950 2.475 Y MAGEA3 n/a
11 TRCN0000144761 GATTGGGAAATCCATTCCATT pLKO.1 1446 3UTR 100% 4.950 2.475 Y MAGEA2B n/a
12 TRCN0000152384 GATTGGGAAATCCATTCCATT pLKO.1 1446 3UTR 100% 4.950 2.475 Y MAGEA6 n/a
13 TRCN0000127630 CTGATAATCGTCCTGGCCATA pLKO.1 782 CDS 100% 4.050 2.025 Y MAGEA3 n/a
14 TRCN0000142536 GCCACTTGTACATCCTTGTCA pLKO.1 696 CDS 100% 3.000 1.500 Y MAGEA12 n/a
15 TRCN0000142910 CTTTCCTGTGATCTTCAGCAA pLKO.1 616 CDS 100% 2.640 1.320 Y MAGEA12 n/a
16 TRCN0000141457 CAGCTATGTGAAAGTCCTGCA pLKO.1 1021 CDS 100% 2.160 1.080 Y MAGEA12 n/a
17 TRCN0000155661 CCTGTGATCTTCAGCAAAGCT pLKO.1 620 CDS 100% 3.000 1.500 Y MAGEA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005367.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.