Transcript: Human NM_005373.3

Homo sapiens MPL proto-oncogene, thrombopoietin receptor (MPL), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
MPL (4352)
Length:
3633
CDS:
32..1939

Additional Resources:

NCBI RefSeq record:
NM_005373.3
NBCI Gene record:
MPL (4352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358938 ATCCAATAGGATCTCGTTAAT pLKO_005 2325 3UTR 100% 13.200 18.480 N MPL n/a
2 TRCN0000059196 CCTACCTACCACTAAGCTATT pLKO.1 1905 CDS 100% 10.800 8.640 N MPL n/a
3 TRCN0000358939 TCCTGCCTCTTTGAGTATATT pLKO_005 2424 3UTR 100% 15.000 10.500 N MPL n/a
4 TRCN0000059197 GTCACGAAATGACAGCATTAT pLKO.1 1096 CDS 100% 13.200 9.240 N MPL n/a
5 TRCN0000359020 CTACCTACCACTAAGCTATTG pLKO_005 1906 CDS 100% 10.800 7.560 N MPL n/a
6 TRCN0000059193 GAAGTGTTTCTCCCGAACATT pLKO.1 145 CDS 100% 5.625 3.938 N MPL n/a
7 TRCN0000059194 GCCCAAGAGACCTGTTATCAA pLKO.1 1283 CDS 100% 5.625 3.938 N MPL n/a
8 TRCN0000059195 CCTCTGGGTGAAGAATGTGTT pLKO.1 355 CDS 100% 4.950 3.465 N MPL n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2875 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2875 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.