Transcript: Human NM_005422.2

Homo sapiens tectorin alpha (TECTA), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
TECTA (7007)
Length:
6468
CDS:
1..6468

Additional Resources:

NCBI RefSeq record:
NM_005422.2
NBCI Gene record:
TECTA (7007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425819 CAATGATAAGCTCCGATATTT pLKO_005 5964 CDS 100% 15.000 21.000 N TECTA n/a
2 TRCN0000427323 GTACTCAGACATAGGTCTATT pLKO_005 2478 CDS 100% 13.200 18.480 N TECTA n/a
3 TRCN0000073542 GCATATCTACTGCCGTGGAAA pLKO.1 1271 CDS 100% 4.950 6.930 N TECTA n/a
4 TRCN0000073539 CCGCACGATCAATGTGGAATT pLKO.1 5667 CDS 100% 0.000 0.000 N TECTA n/a
5 TRCN0000073541 CCGCACTGTCTATGTCAATAA pLKO.1 186 CDS 100% 13.200 10.560 N TECTA n/a
6 TRCN0000073540 GCCCGTCTACTTCTACATTAA pLKO.1 4629 CDS 100% 13.200 10.560 N TECTA n/a
7 TRCN0000421033 ACAATGGTTTCAACGTCATTA pLKO_005 4799 CDS 100% 13.200 9.240 N TECTA n/a
8 TRCN0000073538 CGCACGATCAATGTGGAATTT pLKO.1 5668 CDS 100% 13.200 9.240 N TECTA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.