Transcript: Human NM_005479.4

Homo sapiens FRAT regulator of WNT signaling pathway 1 (FRAT1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FRAT1 (10023)
Length:
2645
CDS:
184..1023

Additional Resources:

NCBI RefSeq record:
NM_005479.4
NBCI Gene record:
FRAT1 (10023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005479.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062463 CTGCAGTTACGTGCAAAGCTT pLKO.1 856 CDS 100% 3.000 4.200 N FRAT1 n/a
2 TRCN0000062467 CGACGCGGGTCCCAACCAGAA pLKO.1 736 CDS 100% 0.000 0.000 N FRAT1 n/a
3 TRCN0000432488 AGTCAGTAGGACTCCTTATTT pLKO_005 1268 3UTR 100% 15.000 10.500 N FRAT1 n/a
4 TRCN0000421146 GAGGAGAACATGAGTAGATAA pLKO_005 1468 3UTR 100% 13.200 9.240 N FRAT1 n/a
5 TRCN0000428309 AGGCCGTGCGAAGGCTTCATT pLKO_005 827 CDS 100% 1.875 1.313 N FRAT1 n/a
6 TRCN0000062466 GCTCAGAACTGGCGACGGCGT pLKO.1 984 CDS 100% 0.000 0.000 N FRAT1 n/a
7 TRCN0000062464 GCTCTCTGGAAACCTCATCAA pLKO.1 804 CDS 100% 4.950 2.970 N FRAT1 n/a
8 TRCN0000062465 GCTTCCTCCTACTGCAGCAGT pLKO.1 254 CDS 100% 0.880 0.528 N FRAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005479.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.