Transcript: Human NM_005559.4

Homo sapiens laminin subunit alpha 1 (LAMA1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LAMA1 (284217)
Length:
9642
CDS:
78..9305

Additional Resources:

NCBI RefSeq record:
NM_005559.4
NBCI Gene record:
LAMA1 (284217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119121 CCCGATTTATGTGGGTGGATT pLKO.1 7373 CDS 100% 4.950 6.930 N LAMA1 n/a
2 TRCN0000119118 CCCATTTATGTTGGTGGCTAT pLKO.1 9120 CDS 100% 4.050 5.670 N LAMA1 n/a
3 TRCN0000119119 GCAGTGTCAATGTGAGCATAA pLKO.1 941 CDS 100% 10.800 7.560 N LAMA1 n/a
4 TRCN0000119120 GCTGGAAGAATTGGAGGTATT pLKO.1 5294 CDS 100% 10.800 7.560 N LAMA1 n/a
5 TRCN0000119117 CCTCAGTTGGAATCATTGCTA pLKO.1 9320 3UTR 100% 3.000 2.100 N LAMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.