Transcript: Human NM_005570.4

Homo sapiens lectin, mannose binding 1 (LMAN1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LMAN1 (3998)
Length:
4824
CDS:
22..1554

Additional Resources:

NCBI RefSeq record:
NM_005570.4
NBCI Gene record:
LMAN1 (3998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416038 CCAGAATATGAGGTCTAATTA pLKO_005 1922 3UTR 100% 15.000 21.000 N LMAN1 n/a
2 TRCN0000057432 CAGCGAAATATGCCATCAAAT pLKO.1 1384 CDS 100% 13.200 9.240 N LMAN1 n/a
3 TRCN0000057429 CCGAGCAAAGATTACCTATTA pLKO.1 624 CDS 100% 13.200 9.240 N LMAN1 n/a
4 TRCN0000433125 GAGCTGATGGCCTAGCAATTT pLKO_005 377 CDS 100% 13.200 9.240 N LMAN1 n/a
5 TRCN0000057430 CGCCCACACCAGATAAAGAAA pLKO.1 842 CDS 100% 5.625 3.938 N LMAN1 n/a
6 TRCN0000057431 CGAGTACAAATACAGCTTCAA pLKO.1 159 CDS 100% 4.950 3.465 N LMAN1 n/a
7 TRCN0000057428 GCACATAGTAAAGAGGGACAT pLKO.1 1350 CDS 100% 4.050 2.835 N LMAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.