Transcript: Human NM_005611.4

Homo sapiens RB transcriptional corepressor like 2 (RBL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
RBL2 (5934)
Length:
4854
CDS:
87..3506

Additional Resources:

NCBI RefSeq record:
NM_005611.4
NBCI Gene record:
RBL2 (5934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218050 GAGCAGAGCTTAATCGAATTT pLKO_005 450 CDS 100% 13.200 18.480 N RBL2 n/a
2 TRCN0000039927 CCAGAACATTATGCGTTGTTA pLKO.1 2813 CDS 100% 5.625 7.875 N RBL2 n/a
3 TRCN0000039924 GCCAGGTGTATAGAAGTGTTT pLKO.1 2857 CDS 100% 4.950 6.930 N RBL2 n/a
4 TRCN0000039926 CCACACCACTAACTGGTGTTA pLKO.1 1285 CDS 100% 0.495 0.396 N RBL2 n/a
5 TRCN0000435469 AGAACTTGTGAACCCTAATTT pLKO_005 827 CDS 100% 15.000 10.500 N Rbl2 n/a
6 TRCN0000235444 AGACATCTGGACCAGTTATTA pLKO_005 2742 CDS 100% 15.000 10.500 N RBL2 n/a
7 TRCN0000235445 ATTTCTGGAAACCCTATATTA pLKO_005 973 CDS 100% 15.000 10.500 N RBL2 n/a
8 TRCN0000235443 CAGGCTAAACATCCAATATTT pLKO_005 4241 3UTR 100% 15.000 10.500 N RBL2 n/a
9 TRCN0000218732 GACTAGGAGACATGGATTTAT pLKO_005 1624 CDS 100% 15.000 10.500 N RBL2 n/a
10 TRCN0000039925 CCTTACATGATGGCCTAGTTT pLKO.1 928 CDS 100% 5.625 3.938 N RBL2 n/a
11 TRCN0000039923 GCTGAGAGAAATATGGAACTT pLKO.1 4719 3UTR 100% 4.950 3.465 N RBL2 n/a
12 TRCN0000010408 GATCTTCATTGGTTAGCATGT pLKO.1 333 CDS 100% 4.050 2.835 N RBL2 n/a
13 TRCN0000010409 TACTTCAGCAACAGTCCTTCA pLKO.1 3312 CDS 100% 4.050 2.835 N RBL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.