Transcript: Human NM_005686.3

Homo sapiens SRY-box transcription factor 13 (SOX13), mRNA.

Source:
NCBI, updated 2019-06-15
Taxon:
Homo sapiens (human)
Gene:
SOX13 (9580)
Length:
4076
CDS:
599..2467

Additional Resources:

NCBI RefSeq record:
NM_005686.3
NBCI Gene record:
SOX13 (9580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422825 TCTATCACCAGGATCGCTTTG pLKO_005 2894 3UTR 100% 6.000 8.400 N SOX13 n/a
2 TRCN0000013478 CCTAAGACTATGTTGGTACTT pLKO.1 2542 3UTR 100% 4.950 6.930 N SOX13 n/a
3 TRCN0000430097 CCTGCAAACCAGTGGAGTATC pLKO_005 1362 CDS 100% 10.800 7.560 N SOX13 n/a
4 TRCN0000417888 TCCAGCTTCTGGTCATGATTC pLKO_005 1047 CDS 100% 10.800 7.560 N SOX13 n/a
5 TRCN0000416510 TTCATCTCTGCCAAGCCTATT pLKO_005 2952 3UTR 100% 10.800 7.560 N SOX13 n/a
6 TRCN0000013479 AGGAACTCTATGGAAGCCAAA pLKO.1 986 CDS 100% 4.050 2.835 N SOX13 n/a
7 TRCN0000013480 CCAGCAGGTTAACATGCCTTA pLKO.1 1255 CDS 100% 4.050 2.835 N SOX13 n/a
8 TRCN0000013481 GAAGCTGGACTTCAACCGAAA pLKO.1 898 CDS 100% 4.050 2.835 N SOX13 n/a
9 TRCN0000013482 CCAGGAGAAGCAGCCCTACTA pLKO.1 1999 CDS 100% 1.650 1.155 N SOX13 n/a
10 TRCN0000412315 ACCTCAGCCTTTAGGGCTTAT pLKO_005 2705 3UTR 100% 10.800 6.480 N SOX13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.