Transcript: Human NM_005707.2

Homo sapiens programmed cell death 7 (PDCD7), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PDCD7 (10081)
Length:
2823
CDS:
28..1485

Additional Resources:

NCBI RefSeq record:
NM_005707.2
NBCI Gene record:
PDCD7 (10081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421464 GACTAAACTGCAACTTCTAAA pLKO_005 1565 3UTR 100% 13.200 18.480 N PDCD7 n/a
2 TRCN0000438236 TGCCATCCGATCATCCCAAAG pLKO_005 1385 CDS 100% 6.000 8.400 N PDCD7 n/a
3 TRCN0000153680 CGTACTATCTGAAGTGAGGAA pLKO.1 927 CDS 100% 2.640 3.696 N PDCD7 n/a
4 TRCN0000150873 GTTATGCTAGAAGGAGAACAA pLKO.1 1150 CDS 100% 4.950 3.960 N PDCD7 n/a
5 TRCN0000157384 GATCCAGATGAGTTCCCACTT pLKO.1 1267 CDS 100% 4.050 3.240 N PDCD7 n/a
6 TRCN0000424468 CATCCAGATCAGGCATGATTG pLKO_005 1350 CDS 100% 10.800 7.560 N PDCD7 n/a
7 TRCN0000157691 CAGGCATGATTGGGATCAGTA pLKO.1 1359 CDS 100% 4.950 3.465 N PDCD7 n/a
8 TRCN0000153659 CCTACCCTGAAGTTATGCTTT pLKO.1 1602 3UTR 100% 4.950 3.465 N PDCD7 n/a
9 TRCN0000150624 GAAACGTGAAATTGAGTCCAA pLKO.1 1236 CDS 100% 2.640 1.848 N PDCD7 n/a
10 TRCN0000437781 AGCAACGACATCTGGGCAACT pLKO_005 1447 CDS 100% 4.050 2.430 N PDCD7 n/a
11 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2387 3UTR 100% 4.950 2.475 Y GJD4 n/a
12 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2387 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.