Transcript: Human NM_005760.3

Homo sapiens CCAAT enhancer binding protein zeta (CEBPZ), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CEBPZ (10153)
Length:
3346
CDS:
30..3194

Additional Resources:

NCBI RefSeq record:
NM_005760.3
NBCI Gene record:
CEBPZ (10153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231250 AGGCTACTCTTCCGCTCAAAT pLKO_005 1305 CDS 100% 13.200 18.480 N Cebpz n/a
2 TRCN0000338461 AGGCTACTCTTCCGCTCAAAT pLKO_005 1305 CDS 100% 13.200 18.480 N CEBPZ n/a
3 TRCN0000338434 ATCTTAATTTGGCGAAGTATA pLKO_005 298 CDS 100% 13.200 18.480 N CEBPZ n/a
4 TRCN0000017947 GCAGACAATATCGGATCGATA pLKO.1 1640 CDS 100% 4.950 6.930 N CEBPZ n/a
5 TRCN0000017946 GCAGCCATGATTCTTCTTATT pLKO.1 774 CDS 100% 13.200 9.240 N CEBPZ n/a
6 TRCN0000338497 GCAGCCATGATTCTTCTTATT pLKO_005 774 CDS 100% 13.200 9.240 N CEBPZ n/a
7 TRCN0000017945 CCATTTATATGTGGAGCTTTA pLKO.1 1827 CDS 100% 10.800 7.560 N CEBPZ n/a
8 TRCN0000338499 GATCGATTTGTATACCGAAAT pLKO_005 2298 CDS 100% 10.800 7.560 N CEBPZ n/a
9 TRCN0000017943 CGCTCAAATATCAGCTCCAAA pLKO.1 1317 CDS 100% 4.950 3.465 N CEBPZ n/a
10 TRCN0000017944 GCACCAAGCAAGATTACCTTA pLKO.1 178 CDS 100% 4.950 3.465 N CEBPZ n/a
11 TRCN0000338496 GCACCAAGCAAGATTACCTTA pLKO_005 178 CDS 100% 4.950 3.465 N CEBPZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.