Transcript: Human NM_005782.4

Homo sapiens Aly/REF export factor (ALYREF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ALYREF (10189)
Length:
1097
CDS:
7..801

Additional Resources:

NCBI RefSeq record:
NM_005782.4
NBCI Gene record:
ALYREF (10189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315124 GACGCCTATAATGCGAGAATG pLKO_005 769 CDS 100% 10.800 15.120 N ALYREF n/a
2 TRCN0000000353 ACTATGATCGCTCTGGTCGCA pLKO.1 440 CDS 100% 0.660 0.924 N ALYREF n/a
3 TRCN0000315059 GGAGTCTCAGACGCCGATATT pLKO_005 373 CDS 100% 13.200 9.240 N ALYREF n/a
4 TRCN0000000352 GAACTCTTTGCTGAATTTGGA pLKO.1 397 CDS 100% 3.000 2.100 N ALYREF n/a
5 TRCN0000315058 GAACTCTTTGCTGAATTTGGA pLKO_005 397 CDS 100% 3.000 2.100 N ALYREF n/a
6 TRCN0000000351 TCAGACGCCGATATTCAGGAA pLKO.1 379 CDS 100% 2.640 1.848 N ALYREF n/a
7 TRCN0000010518 CGTGGAGACAGGTGGGAAACT pLKO.1 330 CDS 100% 1.650 1.155 N ALYREF n/a
8 TRCN0000315057 CGTGGAGACAGGTGGGAAACT pLKO_005 330 CDS 100% 1.650 1.155 N ALYREF n/a
9 TRCN0000000350 CTTTGCTGAATTTGGAACGCT pLKO.1 402 CDS 100% 0.750 0.525 N ALYREF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.