Transcript: Human NM_005786.6

Homo sapiens teashirt zinc finger homeobox 1 (TSHZ1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TSHZ1 (10194)
Length:
4944
CDS:
543..3641

Additional Resources:

NCBI RefSeq record:
NM_005786.6
NBCI Gene record:
TSHZ1 (10194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005786.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422448 GGGTGCACATCTCGAAGTTTA pLKO_005 3184 CDS 100% 13.200 18.480 N TSHZ1 n/a
2 TRCN0000437173 GAGCGCTTTGCAGTCCATCAT pLKO_005 2645 CDS 100% 4.950 6.930 N TSHZ1 n/a
3 TRCN0000413508 TAAGCTCTGCAACCGGACTTT pLKO_005 3524 CDS 100% 4.950 6.930 N TSHZ1 n/a
4 TRCN0000019525 CCAGCTTAGCTCTGGATTTAA pLKO.1 796 CDS 100% 15.000 12.000 N TSHZ1 n/a
5 TRCN0000435941 ACACTACTCAGAGACATTATT pLKO_005 3907 3UTR 100% 15.000 10.500 N TSHZ1 n/a
6 TRCN0000414269 TGAAGTTGCCATGACAATAAA pLKO_005 3980 3UTR 100% 15.000 10.500 N TSHZ1 n/a
7 TRCN0000438521 GAAGACTTGGGCTCCACATTC pLKO_005 3498 CDS 100% 10.800 7.560 N TSHZ1 n/a
8 TRCN0000019526 CCTGATCTATGTGACTGAGTT pLKO.1 3608 CDS 100% 4.950 3.465 N TSHZ1 n/a
9 TRCN0000019524 GCCATTAGCAAAGCTCAGAAT pLKO.1 2091 CDS 100% 4.950 3.465 N TSHZ1 n/a
10 TRCN0000019527 GAGAATAAAGATTTCCCGAAA pLKO.1 2433 CDS 100% 4.050 2.835 N TSHZ1 n/a
11 TRCN0000019528 GCCAGCAAGTTCCGGTGCAAA pLKO.1 1134 CDS 100% 1.650 1.155 N TSHZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005786.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.