Transcript: Human NM_005824.3

Homo sapiens leucine rich repeat containing 17 (LRRC17), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LRRC17 (10234)
Length:
2169
CDS:
287..1228

Additional Resources:

NCBI RefSeq record:
NM_005824.3
NBCI Gene record:
LRRC17 (10234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243111 CTTGAGCTACCTGCGTCTTTA pLKO_005 748 CDS 100% 13.200 18.480 N LRRC17 n/a
2 TRCN0000166997 GCGTATTAGAAGACTTGTATT pLKO.1 1340 3UTR 100% 13.200 18.480 N LRRC17 n/a
3 TRCN0000243112 ATTAACTGTGTTGCCTATTTA pLKO_005 1739 3UTR 100% 15.000 10.500 N LRRC17 n/a
4 TRCN0000243110 CTTGACTTGTCATACAATAAA pLKO_005 1103 CDS 100% 15.000 10.500 N LRRC17 n/a
5 TRCN0000172319 CCGTGTGACGTGTACACATAT pLKO.1 443 CDS 100% 13.200 9.240 N LRRC17 n/a
6 TRCN0000243113 TGACGGAGGAAGTGTTCATTT pLKO_005 717 CDS 100% 13.200 9.240 N LRRC17 n/a
7 TRCN0000167520 GAACAGTTGTGTAATGAAGAA pLKO.1 911 CDS 100% 4.950 3.465 N LRRC17 n/a
8 TRCN0000243114 GTGAGATAGAAACGCTTATTT pLKO_005 792 CDS 100% 15.000 9.000 N LRRC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.