Transcript: Human NM_005858.4

Homo sapiens A-kinase anchoring protein 8 (AKAP8), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AKAP8 (10270)
Length:
3665
CDS:
57..2135

Additional Resources:

NCBI RefSeq record:
NM_005858.4
NBCI Gene record:
AKAP8 (10270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229896 ACGTCTTAGCAGAGGTGATTA pLKO_005 1783 CDS 100% 13.200 18.480 N AKAP8 n/a
2 TRCN0000037948 GTATGCAAGTTCCGTAGCTTT pLKO.1 1236 CDS 100% 4.950 6.930 N AKAP8 n/a
3 TRCN0000257238 ACGGAAGCAGTTCCAACTTTA pLKO_005 968 CDS 100% 13.200 10.560 N AKAP8 n/a
4 TRCN0000037947 CCAGCTGGCAAGGTTATGAAA pLKO.1 136 CDS 100% 5.625 4.500 N AKAP8 n/a
5 TRCN0000229897 ATTAGTTACTACCACTCAAAT pLKO_005 2862 3UTR 100% 13.200 9.240 N AKAP8 n/a
6 TRCN0000229895 CAGAGCCATGCACCGACAATT pLKO_005 301 CDS 100% 13.200 9.240 N AKAP8 n/a
7 TRCN0000037946 CCTCCAGGAATACATTGTAAA pLKO.1 1352 CDS 100% 13.200 9.240 N AKAP8 n/a
8 TRCN0000218647 CAATTTAGGAGGTGAGGATAA pLKO_005 1733 CDS 100% 10.800 7.560 N AKAP8 n/a
9 TRCN0000037945 GCTGCTGAACAGTTCAAGAAA pLKO.1 1587 CDS 100% 5.625 3.938 N AKAP8 n/a
10 TRCN0000037944 GCAGAGTCTAAAGACGCTGTT pLKO.1 2103 CDS 100% 4.050 2.835 N AKAP8 n/a
11 TRCN0000088771 GCCTGTTCTGTATGCAAGTTT pLKO.1 1227 CDS 100% 5.625 3.938 N Akap8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.