Transcript: Human NM_005934.4

Homo sapiens MLLT1 super elongation complex subunit (MLLT1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MLLT1 (4298)
Length:
4532
CDS:
192..1871

Additional Resources:

NCBI RefSeq record:
NM_005934.4
NBCI Gene record:
MLLT1 (4298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414475 GTGATGGTAATGCCCGAAGGA pLKO_005 612 CDS 100% 2.640 3.696 N MLLT1 n/a
2 TRCN0000417443 CCTTTCTGAGCAGCGGATCGA pLKO_005 2231 3UTR 100% 0.880 1.232 N MLLT1 n/a
3 TRCN0000019291 CGAGAAGCTCACCTTCAACAA pLKO.1 548 CDS 100% 4.950 3.960 N MLLT1 n/a
4 TRCN0000432169 CAAGACCTCCAAGCCACACAA pLKO_005 758 CDS 100% 4.950 3.465 N MLLT1 n/a
5 TRCN0000019290 GCCTGAGAAGATCCTCAAGAA pLKO.1 1634 CDS 100% 4.950 3.465 N MLLT1 n/a
6 TRCN0000019292 CGCTGGCTTCATCATGCCCAT pLKO.1 425 CDS 100% 0.720 0.504 N MLLT1 n/a
7 TRCN0000019293 GCAGATTGTGAATCTGATCGA pLKO.1 1739 CDS 100% 0.264 0.185 N MLLT1 n/a
8 TRCN0000426569 TGCCTTCAAGGAACCCAAGAT pLKO_005 938 CDS 100% 4.950 2.970 N MLLT1 n/a
9 TRCN0000019289 GCAATGTGACATCCAGCACTT pLKO.1 311 CDS 100% 4.050 2.430 N MLLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.