Transcript: Human NM_005996.4

Homo sapiens T-box transcription factor 3 (TBX3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
TBX3 (6926)
Length:
4733
CDS:
976..3147

Additional Resources:

NCBI RefSeq record:
NM_005996.4
NBCI Gene record:
TBX3 (6926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005076 CGTGGTTTATATGTCCGGGAT pLKO.1 3325 3UTR 100% 2.160 3.024 N TBX3 n/a
2 TRCN0000432874 GCGAATGTTTCCTCCATTTAA pLKO_005 1365 CDS 100% 15.000 10.500 N TBX3 n/a
3 TRCN0000432455 TCTCCCTCAGTGCGGATTTAT pLKO_005 3486 3UTR 100% 15.000 10.500 N TBX3 n/a
4 TRCN0000005078 GCTGCTGATGACTGTCGTTAT pLKO.1 1444 CDS 100% 10.800 7.560 N TBX3 n/a
5 TRCN0000005080 CCAAGCCGATCATGGATCAAT pLKO.1 1157 CDS 100% 5.625 3.938 N TBX3 n/a
6 TRCN0000005077 GCATACCAGAATGATAAGATA pLKO.1 1762 CDS 100% 5.625 3.938 N TBX3 n/a
7 TRCN0000005079 CGTCACTTTCCACAAACTGAA pLKO.1 1578 CDS 100% 4.950 3.465 N TBX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.