Transcript: Human NM_006035.4

Homo sapiens CDC42 binding protein kinase beta (CDC42BPB), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CDC42BPB (9578)
Length:
6844
CDS:
377..5512

Additional Resources:

NCBI RefSeq record:
NM_006035.4
NBCI Gene record:
CDC42BPB (9578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199584 GCTCAGCTAGTGAGCAAGAAA pLKO.1 3282 CDS 100% 0.563 0.788 N CDC42BPB n/a
2 TRCN0000199142 CCCAGGGAGAAGATCGTAATC pLKO.1 4238 CDS 100% 10.800 8.640 N CDC42BPB n/a
3 TRCN0000199640 GCGAGGTTCTACATTGGTGAA pLKO.1 905 CDS 100% 4.050 3.240 N CDC42BPB n/a
4 TRCN0000000854 GCAGTCCAACACATTAACCAA pLKO.1 1633 CDS 100% 3.000 2.400 N CDC42BPB n/a
5 TRCN0000342232 GCAGTCCAACACATTAACCAA pLKO_005 1633 CDS 100% 3.000 2.400 N CDC42BPB n/a
6 TRCN0000199109 CTGACCCTGCTCAGCAAATTT pLKO.1 860 CDS 100% 15.000 10.500 N CDC42BPB n/a
7 TRCN0000000855 CAGCAATTCAAACCGAGATAA pLKO.1 1810 CDS 100% 13.200 9.240 N CDC42BPB n/a
8 TRCN0000342233 CAGCAATTCAAACCGAGATAA pLKO_005 1810 CDS 100% 13.200 9.240 N CDC42BPB n/a
9 TRCN0000199663 GAGGAGGCAGTAGGTACAATA pLKO.1 2630 CDS 100% 13.200 9.240 N CDC42BPB n/a
10 TRCN0000342293 GAGGAGGCAGTAGGTACAATA pLKO_005 2630 CDS 100% 13.200 9.240 N CDC42BPB n/a
11 TRCN0000199412 CCATGAAGTGTCACCAGTATC pLKO.1 6136 3UTR 100% 10.800 7.560 N CDC42BPB n/a
12 TRCN0000194904 CTGTACTTAGTCATGGATTAC pLKO.1 821 CDS 100% 10.800 7.560 N CDC42BPB n/a
13 TRCN0000196846 GAAACTTTCCTAGGACCTTAA pLKO.1 5911 3UTR 100% 10.800 7.560 N CDC42BPB n/a
14 TRCN0000195057 CCACAGAAAGTTCAATGAGAT pLKO.1 4465 CDS 100% 4.950 3.465 N CDC42BPB n/a
15 TRCN0000342294 CCACAGAAAGTTCAATGAGAT pLKO_005 4465 CDS 100% 4.950 3.465 N CDC42BPB n/a
16 TRCN0000000853 TCACCCTTTGTACCAGATGTT pLKO.1 6476 3UTR 100% 4.950 3.465 N CDC42BPB n/a
17 TRCN0000010559 GATTACTATGTGGGTGGTGAT pLKO.1 836 CDS 100% 4.050 2.835 N CDC42BPB n/a
18 TRCN0000000856 CCACCAAACACTCAACTCCAT pLKO.1 5394 CDS 100% 2.640 1.848 N CDC42BPB n/a
19 TRCN0000022690 GCAGATTCAAACAGGCTCGAA pLKO.1 1880 CDS 100% 2.640 2.112 N Cdc42bpb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.