Transcript: Human NM_006040.3

Homo sapiens heparan sulfate-glucosamine 3-sulfotransferase 4 (HS3ST4), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HS3ST4 (9951)
Length:
3267
CDS:
460..1830

Additional Resources:

NCBI RefSeq record:
NM_006040.3
NBCI Gene record:
HS3ST4 (9951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440025 TGTCAGAGACAGTGCTATTAA pLKO_005 2139 3UTR 100% 15.000 21.000 N HS3ST4 n/a
2 TRCN0000441883 AGACTTTGGATGGGCAAATAA pLKO_005 1208 CDS 100% 15.000 10.500 N HS3ST4 n/a
3 TRCN0000035795 CCAAGTTACTTTGTGACAAAT pLKO.1 1243 CDS 100% 13.200 9.240 N HS3ST4 n/a
4 TRCN0000035794 CCCATCAGTTTGATTCAATTA pLKO.1 3073 3UTR 100% 13.200 9.240 N HS3ST4 n/a
5 TRCN0000448165 TCTTATCTTCTGCTAGTTAAT pLKO_005 2085 3UTR 100% 13.200 9.240 N HS3ST4 n/a
6 TRCN0000035797 CCACAGACTGAGGAAATTCTA pLKO.1 1734 CDS 100% 5.625 3.938 N HS3ST4 n/a
7 TRCN0000035796 GCCAAGGACATCAAACTGATT pLKO.1 1291 CDS 100% 4.950 3.465 N HS3ST4 n/a
8 TRCN0000035798 GCCTCAAACGTGTTGTGACTA pLKO.1 1586 CDS 100% 4.950 3.960 N HS3ST4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.