Transcript: Human NM_006062.3

Homo sapiens SMYD family member 5 (SMYD5), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SMYD5 (10322)
Length:
2554
CDS:
23..1279

Additional Resources:

NCBI RefSeq record:
NM_006062.3
NBCI Gene record:
SMYD5 (10322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006062.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154724 GCCAATGAAGAGGAGGAAATT pLKO.1 614 CDS 100% 13.200 9.240 N SMYD5 n/a
2 TRCN0000155727 CCATAAACTTCTGGGAGACAA pLKO.1 637 CDS 100% 4.950 3.465 N SMYD5 n/a
3 TRCN0000157653 GAACCCAATGTGACCTCAGAA pLKO.1 1181 CDS 100% 4.950 3.465 N SMYD5 n/a
4 TRCN0000155068 GACTGCAAGCATCATGTTGAT pLKO.1 511 CDS 100% 4.950 3.465 N SMYD5 n/a
5 TRCN0000155095 GCTATGGGAATTACAACCCAT pLKO.1 2316 3UTR 100% 0.264 0.185 N SMYD5 n/a
6 TRCN0000156306 CTGTGACACTCTGGAGTTGAA pLKO.1 823 CDS 100% 4.950 2.970 N SMYD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006062.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.