Transcript: Human NM_006080.3

Homo sapiens semaphorin 3A (SEMA3A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SEMA3A (10371)
Length:
8113
CDS:
204..2519

Additional Resources:

NCBI RefSeq record:
NM_006080.3
NBCI Gene record:
SEMA3A (10371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426619 ACGCTAGAATAGGTCAGATAT pLKO_005 988 CDS 100% 13.200 18.480 N SEMA3A n/a
2 TRCN0000413336 TAAGGAGACTTGGTATGATTT pLKO_005 1598 CDS 100% 13.200 18.480 N SEMA3A n/a
3 TRCN0000058139 CGGTGTGATATTTACGGGAAA pLKO.1 1749 CDS 100% 4.050 5.670 N SEMA3A n/a
4 TRCN0000415975 AGCTGAGTTCCACCAATTATA pLKO_005 2645 3UTR 100% 15.000 10.500 N SEMA3A n/a
5 TRCN0000058140 CCTGAAAGAATGTGCTAATTT pLKO.1 533 CDS 100% 15.000 10.500 N SEMA3A n/a
6 TRCN0000058138 CCTGGTTAATATCAAGGATTT pLKO.1 446 CDS 100% 10.800 7.560 N SEMA3A n/a
7 TRCN0000058142 CCGTTCTTAAAGTAGTTTCAA pLKO.1 1573 CDS 100% 5.625 3.938 N SEMA3A n/a
8 TRCN0000067329 GCAGGATGTATTCCTAATGAA pLKO.1 1127 CDS 100% 5.625 3.938 N Sema3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.