Transcript: Human NM_006133.3

Homo sapiens diacylglycerol lipase alpha (DAGLA), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DAGLA (747)
Length:
5799
CDS:
159..3287

Additional Resources:

NCBI RefSeq record:
NM_006133.3
NBCI Gene record:
DAGLA (747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219841 TTGTGCCATCCGACATCATTG pLKO.1 850 CDS 100% 10.800 15.120 N DAGLA n/a
2 TRCN0000430394 TGCCATGATGCGGTCTATGAA pLKO_005 1275 CDS 100% 5.625 7.875 N DAGLA n/a
3 TRCN0000219842 CTGCGGTGGACATCGTCTATA pLKO.1 1249 CDS 100% 13.200 9.240 N DAGLA n/a
4 TRCN0000419905 GCGACAACAAGGCCTTCAATG pLKO_005 2053 CDS 100% 10.800 7.560 N DAGLA n/a
5 TRCN0000430213 ATCCGACCCTCAAGTGCTTTG pLKO_005 1624 CDS 100% 6.000 4.200 N DAGLA n/a
6 TRCN0000127672 CAAGACAGACTCTCAGATGAA pLKO.1 5138 3UTR 100% 4.950 3.465 N DAGLA n/a
7 TRCN0000129580 CAGTCAGATGCCTACTCAGAA pLKO.1 789 CDS 100% 4.950 3.465 N DAGLA n/a
8 TRCN0000129330 CAAGAATGTCACCCTCGGAAT pLKO.1 551 CDS 100% 4.050 2.835 N DAGLA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.