Transcript: Human NM_006151.3

Homo sapiens lactoperoxidase (LPO), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LPO (4025)
Length:
2821
CDS:
159..2297

Additional Resources:

NCBI RefSeq record:
NM_006151.3
NBCI Gene record:
LPO (4025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415367 ATTACGGGAGACTGCAATAAC pLKO_005 579 CDS 100% 13.200 18.480 N LPO n/a
2 TRCN0000045993 CCGGGAGGTATCTAACAAGAT pLKO.1 734 CDS 100% 4.950 6.930 N LPO n/a
3 TRCN0000045994 GCAGACACTAGAGGAGTTGAA pLKO.1 1892 CDS 100% 4.950 3.960 N LPO n/a
4 TRCN0000045995 CCAAGCTGATGAAACAGAATA pLKO.1 1720 CDS 100% 13.200 9.240 N LPO n/a
5 TRCN0000045997 CCCAGTGTGATGAGTACTGTA pLKO.1 889 CDS 100% 4.950 3.465 N LPO n/a
6 TRCN0000045996 GACCACATGCAGAAGTGGATA pLKO.1 1464 CDS 100% 4.950 3.465 N LPO n/a
7 TRCN0000416900 AGTCTTGGCCCTTAACCTTTA pLKO_005 2584 3UTR 100% 10.800 6.480 N LPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.