Transcript: Human NM_006239.3

Homo sapiens protein phosphatase with EF-hand domain 2 (PPEF2), mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
PPEF2 (5470)
Length:
3343
CDS:
282..2543

Additional Resources:

NCBI RefSeq record:
NM_006239.3
NBCI Gene record:
PPEF2 (5470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002545 CGCGAGAACATACAATCAAGT pLKO.1 2196 CDS 100% 4.950 6.930 N PPEF2 n/a
2 TRCN0000355717 GGACTTCCTGACCCGCATATT pLKO_005 524 CDS 100% 13.200 10.560 N PPEF2 n/a
3 TRCN0000002544 ACCAAGGAAGTGATGAATAAA pLKO.1 1038 CDS 100% 15.000 10.500 N PPEF2 n/a
4 TRCN0000355650 GTCACAACCGCAAGGTATTAA pLKO_005 1774 CDS 100% 15.000 10.500 N PPEF2 n/a
5 TRCN0000002543 GATCCAACCTAGAGACCATTT pLKO.1 2242 CDS 100% 10.800 7.560 N PPEF2 n/a
6 TRCN0000002542 ACATAACTGATCTGGAGCTTT pLKO.1 1171 CDS 100% 4.950 3.465 N PPEF2 n/a
7 TRCN0000002546 CCCACCTCACAATCTTCACAA pLKO.1 2746 3UTR 100% 4.950 2.970 N PPEF2 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3101 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3101 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.