Transcript: Human NM_006242.4

Homo sapiens protein phosphatase 1 regulatory subunit 3D (PPP1R3D), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PPP1R3D (5509)
Length:
3643
CDS:
375..1274

Additional Resources:

NCBI RefSeq record:
NM_006242.4
NBCI Gene record:
PPP1R3D (5509)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356267 ACAACGACCACCGAGACTACA pLKO_005 1180 CDS 100% 4.950 6.930 N PPP1R3D n/a
2 TRCN0000006862 GCTCGCAATCAACTCGGACCT pLKO.1 776 CDS 100% 0.720 1.008 N PPP1R3D n/a
3 TRCN0000356204 CCAAGTCCTCTGACCTAATTT pLKO_005 1377 3UTR 100% 15.000 10.500 N PPP1R3D n/a
4 TRCN0000378109 TCAGGAATATTCTCGATTTAA pLKO_005 1700 3UTR 100% 15.000 10.500 N PPP1R3D n/a
5 TRCN0000006864 AGAGAGCTGGATCCACTTCAT pLKO.1 1250 CDS 100% 4.950 3.465 N PPP1R3D n/a
6 TRCN0000378181 GGCACAGGTCAAGGTGTTCAA pLKO_005 713 CDS 100% 4.950 3.465 N PPP1R3D n/a
7 TRCN0000006860 GCCTTGTTACATTTCCTGCTA pLKO.1 2980 3UTR 100% 2.640 1.848 N PPP1R3D n/a
8 TRCN0000006861 CGTGTCACTTGCTCGGACCTT pLKO.1 915 CDS 100% 0.880 0.616 N PPP1R3D n/a
9 TRCN0000006863 GCGCGTGTGCAACGTGGCCTT pLKO.1 953 CDS 100% 0.000 0.000 N PPP1R3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.