Transcript: Human NM_006247.4

Homo sapiens protein phosphatase 5 catalytic subunit (PPP5C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PPP5C (5536)
Length:
2139
CDS:
11..1510

Additional Resources:

NCBI RefSeq record:
NM_006247.4
NBCI Gene record:
PPP5C (5536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367538 GAGAACAACCTGGACTATATC pLKO_005 1259 CDS 100% 13.200 18.480 N PPP5C n/a
2 TRCN0000367627 CTATGACCTCCTCAACATATT pLKO_005 751 CDS 100% 13.200 10.560 N PPP5C n/a
3 TRCN0000002804 GAAGTACATCAAGGGTTATTA pLKO.1 289 CDS 100% 15.000 10.500 N PPP5C n/a
4 TRCN0000356156 AGAAGTACATCAAGGGTTATT pLKO_005 288 CDS 100% 13.200 9.240 N PPP5C n/a
5 TRCN0000002801 CCACGAGACAGACAACATGAA pLKO.1 919 CDS 100% 4.950 3.465 N PPP5C n/a
6 TRCN0000002803 GAAGAGAACAACCTGGACTAT pLKO.1 1256 CDS 100% 4.950 3.465 N PPP5C n/a
7 TRCN0000002800 CCAGATCACTTTCACCTCCTT pLKO.1 890 CDS 100% 2.640 1.848 N PPP5C n/a
8 TRCN0000367540 CCAGCAATGCCATCTACTATG pLKO_005 186 CDS 100% 10.800 6.480 N PPP5C n/a
9 TRCN0000002802 GAGACAGAGAAGATTACAGTA pLKO.1 707 CDS 100% 4.950 2.970 N PPP5C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.